Isolation, Identification, Characterization and Optimization of Amylase producing organisms from sacred groves of Mahesana District

 

H. V. Prajapati¹, D. D. Prajapati¹, S. A. Bhatt²

¹Dept. of Microbiology, Mahesana Urban Institute of Science, Ganpat University, Mahesana, India.

²Dept. of Life Science, Hemchandracharya North Gujarat University, Patan, India.

 

ABSTRACT:

Amylase is the most widely used Food, fermentation, Starch processing, textile and papermaking.This research was conducted to isolate and identify a local amylase producing bacteria from sacred groves soil and characterize, Bacteria from soil were primarily screened on starch agar medium and out of 49 isolates, 15 were found to be amylase producers, The isolates were screened based on their clear zone ratio, enzyme activities The best isolate demonstrated an enzyme activity of MH-31, MH-48 and MH-43, It was then identified by a combination of biochemical tests, morphological and microscopic characteristics along with 16S rRNA gene sequencing from all six isolate the optimization Temp-35˚C, pH-7, Carbon source-Glucose, Nitrogen Source-Yeast extract, salt Concentraction: 3 this all condition were recoeded.

 

 

 

INTRODUCTION:

Sacred Groves" refer to primitive forests of various sizes that are protected by communities and usually have important religious connotation. Traditionally, the "sacred grove" is a means of biodiversity protection, and can be regarded as the equivalent of ancient nature reserves. In nature reserves, all forms of living things are protected by gods. The components of microorganisms, especially the bacteria of aerobic spore forming Bacillus and related genera, especially the economically important bacteria, have not attracted people's attention (Lyngwi and Joshi, 2015).

 

As the sacred grove play an important role in environment, as the forest area whuch consist variety of microbes in surrounding but still not explore in applicable approach, here we try to explore the industrial enzyme Amylase which having the represent as, high efficiency and ability Work under mild conditions and provide Promising solutions to these challenges (Panneerselvam and Elavarasi, 2015), Amylase is one of the most important enzymes, accounting for about 30% of the world's enzyme production(Kandra, 2003).Amylase is an extracellular enzyme (E.C.3.2.1.1-1,4-αD-gluconic acid hydrolase), which participates in the starch processing industry and breaks down starch into simple sugar components. Alpha amylase is widely used in starch processing, brewing and sugar making, textile industry and detergent manufacturing process (Ekka and Namdeo, 2018). These enzymes are found in animals, plants, bacteria and fungi. Different types of microorganisms, such as bacteria, fungi and yeasts, have been reported as sources of amylase and their characteristics have been described. (Gupta et al., 2008), In Some of the case Amylase obtained from bacteria has greater visibility Stability, high productivity and reduced production costs. Bacillus is the main producer of many extracellular Enzymes, including amylase. Bacillus is the first choice for industrial production of microbial enzymes due to its short fermentation cycle, safe handling, easy operation, consistency, effective enzyme activity under pressure and environmental protection characteristics.(Bala, et al., 2013) Simillarly other research also work on amylase but the rarely work carried out on sacred groves according to the Luang et al., 2019 explore the enzyme amylase from Soil in Nasinuan Community Forest, Maha Sarakham, Thailand, were ,was identify Bacillus sp. 1.1AL2, B. cereus 2.3AL8 and Bacillus sp. 3.5AL2, same as . Bacillus subtilis was report by (Shanmugasundaram et al., 2015), The most important bacterial amylases are Bacillus, Streptomyces, Micrococcus, Escherichia coli, Proteus and Serratia (Van der et al., 2020, Shafiei et al., 2011), Bacillus subtilis and Bacillus mesentericus was reported from sugarcane dump area of Bilaspur, Chhattisgarh. (Ekka and Namdeo, 2018), The development of biology must improve the level of biology to a large extent. Potential to generate a library of enzyme variants, but this is a serious challenge Is to develop a good screening tool that can determine the best choice be nervous (Whitehurst and Oort, 2010), Therefore the aim of this study is to screen microorganisms with the potential to produce amylase from sacred groves from mahesana district. North Gujareat.

 

MATERIAL AND METHOD:

Soil sampling:

Soil sample was carried out from the different sacred groves like1. Jogni Mata Nu Mthanak, Malekpura, Kheralu., 2. Vishvumbhar Mahadev, Ranasipura., 3. Jogi Matana Nu Mandir, Ladol., 4. Vagpuri Maharaj, Kailash Tekri, 5. Saduthala., Amarpuri Maharaj, Basana from Mahesana district.

 

Isolation of bacteria:

Isolation of bacteria was carried out by Serial dilution method. were 1g of each soil sample was mixed in 10 ml of Distilled water and transfer in test tubes for dilution i.e. 10^-1to 10^-10 and further o.1ml of sample was inoculated into sterilized Nutrient agar media plates and spreads on the plates. All the plates were incubated at 37ºC for 24hours.

 

Morphological and biochemical Characterization of bacteria:

Morphologically characterized by Gram’s staining method and characterized biochemically by Catalase test, Oxidase test (Filter paper method), Indole Test, methyl red test, Voges-Proskauer (VP) test, citrate utilization test, gelatin hydrolysis test, Urease test and other Biochemiocal test.

Screening for amylase producing bacteria:

Identify isolates were screened for Amylolytic activity by streaking individual isolate on 1% starch nutrient agar medium. The agar plate was incubated at 37^oC for 24- 48hr, Culture plate was flooded with lugols iodine to identify zones of clearing around culture. The diameter of zone of clearing formed represents Amylolytic activity of the isolated strain.

 

Enzyme production:

Amylase production was carried out by a submerge fermentation technique using production Media containing KH₂PO₄ 15g/l, NH₄N0₃ 10g/l, KCl 0.5g/l, MgSO₄.7H₂O 0.lg/l, FeSO₄.7H₂O 0.01g/l, soluble starch 20g/l, soluble starch 1g/l for bacterial amylase production. The medium was heated to homogenize 30-40ml was distributed into100ml flask and then sterilized by autoclaving. A loop full of the propagated selected strain was inoculated into the medium, the medium was then placed in a shaker incubator operated at 200 rev/min for 72hours [Bahadure et al., 2010].

 

Determination of amylase activity:

Mix 1.0ml sample and equal amount of substrate (1.0% w/v soluble starch) thoroughly, and incubate the test tube in a 37°C water bath for 15 minutes. After 10 minutes, the reaction was terminated by adding 2.0mL of DNS reagent, and the test tube was kept in a boiling water bath for 5 minutes. The test tube was cooled at room temperature, and the absorbance of the substrate and enzyme blank was measured at 540nm. Prepare a blank by replacing the sample and substrate with equal amounts of water. All other reagents are added at the same concentration (Simair et al., 2017)

 

Optimization of amylase activity assay conditions:

The influence of pH, time, Carbon Source of incubation and temperature was measured to optimize enzyme assay condition.

 

Effect of incubation time on enzyme activity:

The effect of incubation time on enzyme production was studied by checking the enzyme activity at 24, 48, 72 and 96 hours.

 

Effect of temperature on enzyme activity:

The influence of temperature is determined by measurement The activity of the enzyme in different temperature ranges Incubate at 30⁰C, 35⁰C, 40⁰C, 45⁰C, 50⁰C.

 

Effect of pH on enzyme activity:

Determine the optimal enzyme activity The activity is measured by running between the pH range of 5.0, 6.0, 7.0, 8.0 and 9.0. The pH was changed by adding 0.1N hydrochloric acid and 0.1N sodium hydroxide.

 

Effect of Salt on enzyme activity:

The effect of Sale concentration on amylase production were determine by using the different concentration of salt such as 1%, 2%, 3%, 4% and 5% by supplementing with nutrient broth.

 

Effect Carbon Source:

The effect of various carbon source such as Sucrose, Glucose, Lactose and Mannitol. At the concentration of 2% was examined for amylase production. The effect of starch concentration on amylase production was determined by supplementing the nutrient broth.

 

Effect of Nitrogen Source:

The effects of nitrogen sources on amylase production were determined by using different nitrogen sources (0.6%) such as Yeast Extract, Beef Extract and Peptone Determination of Effect of Nitrogen varies Source by Yeast Extract, Beef Extract and Peptone and in Carbon Source Sucrose, Glucose, Lactose and Mannitol by supplementing with nutrient broth.

 

RESULTS:

A Total fourty nine strains were isolated with nutrient agar medium and 15 isolates were screen for Amylase activity among them six isolate report the highest positive result and observe the zone of clearance around the colony, when flooded with Lugol`s Iodine Solution. The MH-16, MH-31, MH-42, MH-48 and MH-48 was characterized by Macroscopic, Microscopic and Biochemically, Light Microscopic observation revealed the isolates was rod shape and morphology character was record by observing the colony character.

 

Screening for amylase producing bacteria

 

Figure 1 Amylolytic Plate with treatment of Lugols Iodine

 

The above figure represents the Amylolytic zone which appear in starch agar plate with treatment with Lugols Iodine.

 

Table 1 Highly Potential Reported Isolates.

MH-16	12	22	0.83
MH-31	14	27	0.93
Mh-32	16	21	0.31
MH-42	11	25	1.27
MH-48	15	29	0.93
MH-43	15	24	0.60

 

Table no:1 indicate the potential isolates which report the highest zone as compare to others with colony diameter, zone diameter and its index which varies the 0.60 to 1.27, which indicate the highest zone activity and the diverse varience between isolates and activity.

 

Table 2 Biochemical Analysis of Potential Isolates

Isolates	Size	Shape	Margin	Elevation	Surface	Consistency	Optical Characters	Pigmentation	Gram Reaction
MH-16	Big	Big Rod	Repand	Flat	Vesicular	Dry	Opaque	Red/pink	+ ve
MH-31	Small	Rod	Curled	Flat	Punctate	Dry	Translucent	Golden yellow	+ ve
MH-32	Big	Big Rod	Eurose	Flat	Punctate	Powdery	Opaque	White	+ ve
MH-42	Big	Rod	Wavy	Flat	Vesicular	Dry	Opaque	White	+ ve
MH-48	Small	Rod	Wavy	Flat	Smooth	Moist	Ceraceous	White	+ ve
MH-43	Big	Big Rod	Wavy	Flate	Smooth	Dry	Opaque	White	+ ve

 

Table 3 Macroscopic and Microscopic Observation Potential Isolates

Carbohydrate Fermentation test	Glucose	- Ve	- Ve	+ Ve	- Ve	+ Ve	- Ve
	Mannase	- Ve	- Ve	- Ve	- Ve	+Ve	+Ve
	Fructose	+Ve	+Ve	+Ve	+Ve	+Ve	+Ve
	Sucrose	+Ve	+Ve	+Ve	+Ve	+Ve	+Ve
	Maltose	+Ve	+Ve	+Ve	+Ve	+Ve	+Ve
Indol production		-Ve	-Ve	-Ve	-Ve	-Ve	-Ve
Methyl red test		-Ve	+Ve	+Ve	-Ve	-Ve	-Ve
Vogus proskauer test		+Ve	+Ve	+Ve	+Ve	+Ve	+Ve
Citrate utilization test		-Ve	+Ve	-Ve	+Ve	-Ve	-Ve
Gelatin hydrolysis test		-Ve	-Ve	-Ve	-Ve	-Ve	-Ve
Catalase test		+Ve	+Ve	+Ve	+Ve	+Ve	+Ve
Triple sugar iron test		-Ve	-Ve	-Ve	-Ve	-Ve	-Ve
Urea hydrolysis test		-Ve	-Ve	-Ve	-Ve	-Ve	-Ve
Growth on EMB		-Ve	-Ve	-Ve	-Ve	-Ve	-Ve
Growth on Macconkey		-Ve	-Ve	-Ve	-Ve	-Ve	-Ve
Starch hydrolysis test		+Ve	+Ve	+Ve	+Ve	+Ve	+Ve
Lead acetate test		-Ve	-Ve	-Ve	-Ve	-Ve	-Ve

 

Table: 2 Represent the colony morphology of potential isolates with gram staining which include size, Shape, margin, Elevation, Surface, Consitency, Optical Character, Pigmentation and Gram Reaction, in case of size it varies the large and small among them 4 organisms report big and 2 report small. In case of shape it Boig rod and Rod shape, Margin, it represent the diverse where Repend, Curled, Eurose and Wavy, Elevation of all microbes remain same Flate and in surface it Vesicular and Punculate and Smooth, Consitenct dry and powdery, optical character opaque, translucent and ceracous, with pigment it observe Red, Golden yellow and white. And among all of them the gram reaction report all positive.

 

The table 3 represent the biochemical analysis of potential isolates which include Carbohydrate Fermentation test (Glucose, Mannase, Fructose, Sucrose, Maltose), Indol production, Methyl red test, Vogus proskauer etc. where some reactivity of organisms represent the +ve result and nonresctive represent –ve report.

 

 

Figure 2 Effect of incubation time on enzyme activity

 

Effect of incubation time

The Various time interval was taken to identify the optimum growth in amylase activity where as 24, 48, 72 and 96 among all the isolates highest result was observed in 24hrs and represent the optimum growth as compare to other hours respectively. The Similimary kind of work id reported from Soil samples was collected from rice fields, sugar cane field Sugarcane dump area of Bilaspur, Chhattisgarh. 48 hours was the optimum duration for a maximum amylase activity for all the three colonies NH-1, NH-2 and NH-5 (Ekka and Namdeo, 2018).

 

Effect of temperature:

Enzyme activity at different temperature ranging from 30˚C, 35˚C, 40 ˚C, 45 ˚C, and 50˚C Maximum amylase activity was observed in temperature of 35 .C and then activity are gradually varies at 24 hrs incubation. Where at the time of 30˚C the optimum rate of relative increase, where as the temperature increase from 35 onwards the reactivity.

 

 

Figure 3 Effect of temperature on enzyme activity

 

 

Figure 4 Effect of pH on enzyme activity

 

Effect of pH on enzyme activity

The pH varies from 6 , 7, 8 and 9 pH of fermentation medium was tested for the amylase product all the organisms rise a highest optimum pH 7 which makes the organisms stable and arise the highest growth at pH-7, where the other pH varied the ionic varies which directly effect to the growth of microbes.

 

 

Figure 5 Effect of Salt on enzyme activity

Effect of Salt on enzyme activity:

The activity of salt concentraction varies from 1%, 2%, 3%, 4% and 5%, the highest growth was observed in MH-3 with 3% a's followed by MH-16 with 45 respectively where all the concentraction varies the optimum condition.

 

Figure 6 Effect Carbon Source on enzyme activity

Figure 7 Effect of Nitrogen Source on enzyme activity

 

Isolate	Organisms	Sequence	Acession No	Percentage
MH-31	B.licheniformis	AAGCTTGGTAAAGTGTTGAGTCTCGGGG AAAA ATGAGAAAGAAGAATTGGATGAG	M31123	98.50%
MH-48	B.polymyxa	ATCCTTTCTG AATGTGCTATAATATCGAAATA GACATTGATTGGCCAGCGTATTAAACAATATA	Y00150	96.70%
MH-43	B.cereus	ACAAACCCCTCCATTCAATTTCTAGAAAATAT AGTCTCCGCTGTTCTGGACGTCTCGGTTCATAT	DQ889678	98.30%

 

Effect Carbon Source on enzyme activity:

Various sources of Carbon such Sucrose, Glucose, Lactose and Mannitol were used to replace Starch, which was the original carbon source in growth media. Results obtained showed that, Glucose brought the highest amylase production compared to other carbon sources at 24hour incubation in (Viswanathan et al., 2014) reported that the different carbon sources have varied influences on the extracellular enzymes especially amylase strains. Results obtained showed that increase in concentration of various substrates increases the amylase strain.

 

Effect of Nitrogen Source on enzyme activity

Various sources of nitrogen such as yeast extract, Beef extract and Peptone were used. Results obtained showed that Yeast extract brought the highest amylase activity in MH-43sample compared to other nitrogen source at 24 hrs incubation in both bacterial strains. (Aqeel and Umar, 2010)

 

Molecular Analysis:

Form identification of the isolates over all highly potentioal isolate were carried out the molecular identification, it was subjected to 16 rRNA analysis and on the basis of 16SrRNA, the isolate was identified as B.licheniformis, B.polymyxa, and B.cereus.the sequence analysis and its accession number are depicted in the table.

 

 

CONCLUSION:

This result implies the potential of the industrially important enzyme amylase. In this study, 49 isolates were identified from the different sacred groves, in all Mahesana area, and only 6 isolates were further isolated. Through Gram staining and several biochemical tests, such as catalase test, oxidase test, IMViCtest (indole test, MRVP test, Simon citrate test); determine the amylase activity. Under certain conditions, such as different carbon sources, nitrogen sources, pH, incubation time, temperature and salt concentration, effective colonies are also optimized, and the reserve expresses a high potential and breeds organisms from the sacred Groves.

 

REFERENCS:

1.      Aqeel, B. M., and Umar, D. M. (2010). Effect of alternative carbon and nitrogen sources on production of alpha-amylase by Bacillus megaterium. World Applied Sciences Journal, 8(13), 85-90.

2.      Bahadure, R. B., Agnihotri, U. S., and Akarte, S. R. (2010). Assay of population density of amylase producing bacteria from different soil samples contaminated with flowing effluents. International Journal of Parasitology Research, 2(1), 9.

3.      Bala, J. D., Abioye, O. P., Auta, H. S., Damisa, D., Adabara, N. U., and Tuggen, T. O. (2013). Screening of soil microorganisms for amylase production. Biotechnology an Indian journal, 22-27.

4.      Ekka, A., and Namdeo, N. (2018). Screening, Isolation and Characterization of Amylase Producing Bacteria and optimization for Production of Amylase. IOSR Journal of Biotechnology and Biochemistry, 4, 50-56

5.      Ekka, A., and Namdeo, N. (2018). Screening, Isolation and Characterization of Amylase Producing Bacteria and optimization for Production of Amylase. IOSR Journal of Biotechnology and Biochemistry, 4, 50-56.

6.      Gupta, A., Gupta, V. K., Modi, D. R., and Yadava, L. P. (2008). Production and characterization of α-amylase from Aspergillus niger. Biotechnology, 7(3), 551-556.

7.      Kandra, L. (2003). α-Amylases of medical and industrial importance. Journal of Molecular Structure: theochem, 666, 487-498.

8.      Luang-In, V., Yotchaisarn, M., Saengha, W., Udomwong, P., Deeseenthum, S., and Maneewan, K. (2019). Isolation and Identification of Amylase-producing Bacteria from Soil in Nasinuan Community Forest, Maha Sarakham, Thailand. Biomedical and Pharmacology Journal, 12(3), 1061-1068.

9.      Luang-In, V., Yotchaisarn, M., Saengha, W., Udomwong, P., Deeseenthum, S., and Maneewan, K. (2019). Isolation and Identification of Amylase-producing Bacteria from Soil in Nasinuan Community Forest, Maha Sarakham, Thailand. Biomedical and Pharmacology Journal, 12(3), 1061-1068.

10.   Lyngwi, N. A., and Joshi, S. R. (2015). ‘Traditional Sacred Groves’, an ethnic strategy for conservation of microbial diversity, Vol. 14(3), 474-480.

11.   Panneerselvam, T., and Elavarasi, S. (2015). Isolation of α-amylase producing Bacillus subtilis from soil. Int. J. Curr. Microbiol. App. Sci, 4(2), 543-552.

12.   Shafiei, M., Ziaee, A. A., and Amoozegar, M. A. (2011). Purification and characterization of an organic-solvent-tolerant halophilic α-amylase from the moderately halophilic Nesterenkonia sp. strain F. Journal of industrial microbiology and biotechnology, 38(2), 275-281.

13.   Shanmugasundaram, S., Annadurai, E., Mayavu, P., Surya, M., and Anbarasu, R. (2015). Screening and Identification of Amylase Producing Bacteria from Marakkanam Saltpan Environment, Tamil Nadu, India. Asian Journal of Biomedical and Pharmaceutical Sciences, 5(48), 35.

14.   Simair, A. A., Qureshi, A. S., Khushk, I., Ali, C. H., Lashari, S., Bhutto, M. A., ... and Lu, C. (2017). Production and partial characterization of α-amylase enzyme from Bacillus sp. BCC 01-50 and potential applications. BioMed research international, 2017.

15.   Van der Maarel, M. J., Van der Veen, B., Uitdehaag, J. C., Leemhuis, H., and Dijkhuizen, L. (2002). Properties and applications of starch-converting enzymes of the α-amylase family. Journal of biotechnology, 94(2), 137-155.

16.   Viswanathan, S., Rohini, S., Rajesh, R., and Poomari, K. (2014). Production and medium optimization of amylase by Bacillus spp using submerged fermentation method. World J Chem, 9(1), 01-06.

17.   Whitehurst RJ, Oort MV. Second Edition. Enzymes in Food Technology. Wiley Blackwell Pub; 2010. p. 44-5.

 

 

 

Accepted on 03.10.2020      ©Asian Pharma Press All Right Reserved